pB-Rex
(Plasmid
#122134)
-
PurposeB. subtilis Rex sensor plasmid with gentamicin resistance and pBBR1 origin
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122134 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBBR1
-
Vector typeBacterial Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameB. subtilis Rex
- Promoter apFAB338
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctgggttcgtgccttcatcc
- 3′ sequencing primer ctagaactagggatcccccg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pB-Rex was a gift from Srivatsan Raman (Addgene plasmid # 122134 ; http://n2t.net/addgene:122134 ; RRID:Addgene_122134) -
For your References section:
A Regulatory NADH/NAD+ Redox Biosensor for Bacteria. Liu Y, Landick R, Raman S. ACS Synth Biol. 2019 Feb 15;8(2):264-273. doi: 10.1021/acssynbio.8b00485. Epub 2019 Jan 23. 10.1021/acssynbio.8b00485 PubMed 30633862