Skip to main content

pCP60 RS-GFP
(Plasmid #122173)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 122173 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCP60 (sequence not available in databases) - derivative of pBIN19
  • Backbone manufacturer
    prof. Pascal Ratet (French National Centre for Scientific Research)
  • Backbone size w/o insert (bp) 12400
  • Total vector size (bp) 13636
  • Vector type
    Plant Expression ; binary vector for Escherichia coli and Agrobacterium tumefaciens-mediated plant transformation
  • Selectable markers
    kanamycin in plant cells

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Agrobacterium tumefaciens grow at 28°C
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    RS-GFP
  • Species
    Aequorea victoria
  • Insert Size (bp)
    716
  • GenBank ID
    U70496
  • Promoter CaMV 35S

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SmaI (destroyed during cloning)
  • 5′ sequencing primer CACAATCCCACTATCCTTCG
  • 3′ sequencing primer CTAGTAACATAGATGACACCG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    prof. Pascal Ratet (pCP60 vector backbone); RS-GFP gene originates from Davis, S.J. & Vierstra, R.D. Plant Mol Biol (1998) 36: 521. https://doi.org/10.1023/A:1005991617182 (kindly provided by ABRC)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCP60 RS-GFP was a gift from Lukas Fischer (Addgene plasmid # 122173 ; http://n2t.net/addgene:122173 ; RRID:Addgene_122173)
  • For your References section:

    Cloning of transgenic tobacco BY-2 cells; an efficient method to analyse and reduce high natural heterogeneity of transgene expression. Nocarova E, Fischer L. BMC Plant Biol. 2009 Apr 22;9:44. doi: 10.1186/1471-2229-9-44. 10.1186/1471-2229-9-44 PubMed 19386122