Skip to main content
Addgene

pHAGE mNeonGreen-Core (HBc from HBV) IRES puro
(Plasmid #122202)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 122202 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHAGE
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    HBc from HBV AYW
  • Alt name
    Core, capsid
  • Insert Size (bp)
    547

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer gcctcagacagtggttcaaagtttt
  • 3′ sequencing primer ctttataagggtcgatgtcggaac
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mNeonGreen
  • Alt name
    mNG
  • Insert Size (bp)
    708
  • Tag / Fusion Protein
    • GGSGGSGGS linker (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer ATGGGCATGGACGAGCTGTACAA
  • 3′ sequencing primer cttcggccagtaacgttaggg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHAGE mNeonGreen-Core (HBc from HBV) IRES puro was a gift from Raphael Gaudin (Addgene plasmid # 122202 ; http://n2t.net/addgene:122202 ; RRID:Addgene_122202)
  • For your References section:

    Hypoxia-induced human deoxyribonuclease I is a cellular restriction factor of hepatitis B virus. Hallez C, Li X, Suspene R, Thiers V, Bouzidi MS, M Dorobantu C, Lucansky V, Wain-Hobson S, Gaudin R, Vartanian JP. Nat Microbiol. 2019 Apr 1. pii: 10.1038/s41564-019-0405-x. doi: 10.1038/s41564-019-0405-x. 10.1038/s41564-019-0405-x PubMed 30936483