pHAGE mNeonGreen-Core (HBc from HBV) IRES puro
(Plasmid
#122202)
-
PurposePlasmid coding for mNeonGreen-Core protein (from HBV AYW) and a puromycin resistance in a lentiviral backbone.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 122202 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHAGE
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameHBc from HBV AYW
-
Alt nameCore, capsid
-
Insert Size (bp)547
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer gcctcagacagtggttcaaagtttt
- 3′ sequencing primer ctttataagggtcgatgtcggaac
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemNeonGreen
-
Alt namemNG
-
Insert Size (bp)708
-
Tag
/ Fusion Protein
- GGSGGSGGS linker (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer ATGGGCATGGACGAGCTGTACAA
- 3′ sequencing primer cttcggccagtaacgttaggg
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHAGE mNeonGreen-Core (HBc from HBV) IRES puro was a gift from Raphael Gaudin (Addgene plasmid # 122202 ; http://n2t.net/addgene:122202 ; RRID:Addgene_122202) -
For your References section:
Hypoxia-induced human deoxyribonuclease I is a cellular restriction factor of hepatitis B virus. Hallez C, Li X, Suspene R, Thiers V, Bouzidi MS, M Dorobantu C, Lucansky V, Wain-Hobson S, Gaudin R, Vartanian JP. Nat Microbiol. 2019 Apr 1. pii: 10.1038/s41564-019-0405-x. doi: 10.1038/s41564-019-0405-x. 10.1038/s41564-019-0405-x PubMed 30936483