MSCV-RPS14(WT)-Myc
(Plasmid
#122236)
-
Purposeexpresses RPS14 protein with a Myc tag in mammalian cells (hygro resistance)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 122236 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneMSCV hygro
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 7504
-
Modifications to backboneInsertion in BglII / HpaI cut of the linker: gatctggatcccagtgtggtggtacgtagatatccatccactggcggccgcactcgagcaatgcatggtt, to create more restriction site
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRPS14
-
Alt nameuS11
-
SpeciesH. sapiens (human)
-
Insert Size (bp)530
-
GenBank IDNM_005617
-
Entrez GeneRPS14 (a.k.a. EMTB, S14, uS11)
-
Tag
/ Fusion Protein
- Myc (C terminal on insert)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSCV-RPS14(WT)-Myc was a gift from Gerardo Ferbeyre (Addgene plasmid # 122236 ; http://n2t.net/addgene:122236 ; RRID:Addgene_122236) -
For your References section:
Senescence-associated ribosome biogenesis defects contributes to cell cycle arrest through the Rb pathway. Lessard F, Igelmann S, Trahan C, Huot G, Saint-Germain E, Mignacca L, Del Toro N, Lopes-Paciencia S, Le Calve B, Montero M, Deschenes-Simard X, Bury M, Moiseeva O, Rowell MC, Zorca CE, Zenklusen D, Brakier-Gingras L, Bourdeau V, Oeffinger M, Ferbeyre G. Nat Cell Biol. 2018 Jul;20(7):789-799. doi: 10.1038/s41556-018-0127-y. Epub 2018 Jun 25. 10.1038/s41556-018-0127-y PubMed 29941930