pSiren_EGFP-shHmga1#3
              
              
                (Plasmid
                
                #122289)
              
            
            
            
          - 
            PurposeKnockdown for mouse Hmga1
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 122289 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepSiren_GFP
- 
              Backbone manufacturerClontech
- 
              Vector typeMammalian Expression, Retroviral
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)NEB Stable
- 
            Copy numberUnknown
Gene/Insert
- 
                Gene/Insert nameKnockdown shRNA for mouse Hmga1
- 
                    gRNA/shRNA sequenceGGCTTCCTCCCTGGTTTCTTA
- 
                    SpeciesM. musculus (mouse)
- 
                        Entrez GeneHmga1 (a.k.a. AL023995, Hmga1a, Hmga1b, Hmgi, Hmgiy, Hmgy)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer Unknown (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pSiren_EGFP-shHmga1#3 was a gift from Yukiko Gotoh (Addgene plasmid # 122289 ; http://n2t.net/addgene:122289 ; RRID:Addgene_122289)
- 
                For your References section: HMGA regulates the global chromatin state and neurogenic potential in neocortical precursor cells. Kishi Y, Fujii Y, Hirabayashi Y, Gotoh Y. Nat Neurosci. 2012 Aug;15(8):1127-33. doi: 10.1038/nn.3165. 10.1038/nn.3165 PubMed 22797695
