pMCRW1
(Plasmid
#122462)
-
PurposeHuman NPM-ALK fusion protein gene in pET28a bacterial expression plasmid. Production of recombinant human NPM-ALK fusion protein in E. coli Bl21 Rosetta2 cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 122462 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET28a
- Backbone size w/o insert (bp) 5289
- Total vector size (bp) 7351
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNPM-ALK fusion protein
-
Alt nameNPM-ALK
-
Alt nameAnaplastic Large Cell Lymphoma characteristic fusion protein
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2062
-
Entrez GeneALK (a.k.a. ALK1, CD246, NBLST3)
-
Entrez GeneNPM1 (a.k.a. B23, NPM)
- Promoter T7lac promoter
-
Tag
/ Fusion Protein
- His Tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer taatacgactcactatagggg
- 3′ sequencing primer gctagttattgctcagcgg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMCRW1 was a gift from Richard C. Willson (Addgene plasmid # 122462 ; http://n2t.net/addgene:122462 ; RRID:Addgene_122462) -
For your References section:
Recombinant expression, characterization, and quantification in human cancer cell lines of the Anaplastic Large-Cell Lymphoma-characteristic NPM-ALK fusion protein. Kourentzi K, Crum M, Patil U, Prebisch A, Chavan D, Vu B, Zeng Z, Litvinov D, Zu Y, Willson RC. Sci Rep. 2020 Mar 19;10(1):5078. doi: 10.1038/s41598-020-61936-w. 10.1038/s41598-020-61936-w PubMed 32193476