Skip to main content

tUI
(Plasmid #122661)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 122661 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pET28a
  • Backbone size w/o insert (bp) 5293
  • Total vector size (bp) 5791

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    For protein expression, 8 hour incubation at 30 degree with 0.4 mM IPTG is optimal.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    tUI
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    498
  • GenBank ID
    NM_013438.5 U47927.1
  • Entrez Gene
    UBQLN1 (a.k.a. DA41, DSK2, PLIC-1, UBQN, XDRP1)
  • Entrez Gene
    USP5 (a.k.a. ISOT)
  • Promoter T7 promoter
  • Tag / Fusion Protein
    • His-tag (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    tUI was a gift from Robert Cohen (Addgene plasmid # 122661 ; http://n2t.net/addgene:122661 ; RRID:Addgene_122661)
  • For your References section:

    High-affinity free ubiquitin sensors for quantifying ubiquitin homeostasis and deubiquitination. Choi YS, Bollinger SA, Prada LF, Scavone F, Yao T, Cohen RE. Nat Methods. 2019 Jul 15. pii: 10.1038/s41592-019-0469-9. doi: 10.1038/s41592-019-0469-9. 10.1038/s41592-019-0469-9 PubMed 31308549