tUI-HA
(Plasmid
#122662)
-
PurposeExpress tUI-HA protein in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122662 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepET28a
- Backbone size w/o insert (bp) 5293
- Total vector size (bp) 5839
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFor protein expression, 8 hour incubation at 30 degree with 0.4 mM IPTG is optimal.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametUI-HA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)546
- Promoter T7 promoter
-
Tags
/ Fusion Proteins
- His-tag (N terminal on backbone)
- HA-tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
tUI-HA was a gift from Robert Cohen (Addgene plasmid # 122662 ; http://n2t.net/addgene:122662 ; RRID:Addgene_122662) -
For your References section:
High-affinity free ubiquitin sensors for quantifying ubiquitin homeostasis and deubiquitination. Choi YS, Bollinger SA, Prada LF, Scavone F, Yao T, Cohen RE. Nat Methods. 2019 Jul 15. pii: 10.1038/s41592-019-0469-9. doi: 10.1038/s41592-019-0469-9. 10.1038/s41592-019-0469-9 PubMed 31308549