pMH183
(Plasmid
#122856)
-
PurposeMS2-modified guide RNA targeting the FT promoter with GreenGate D-E flanking sequences
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122856 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMA-RQ
- Backbone size w/o insert (bp) 2421
- Total vector size (bp) 2703
-
Vector typeGolden Gate compatible cloning vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMS2-modified sgRNA targeting the Arabidopsis FT promoter
-
gRNA/shRNA sequenceggatttgcattaactcgggt
-
SpeciesSynthetic
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid is designed for Golden Gate cloning using the enzyme BsaI.
Plasmid Features (listed as bp in full plasmid sequence):
BsaI site #1 = 2241-2246bp
sgRNA-FT-A sequence = 2382-2541bp
BsaI site #2 = 2553-2558bp
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMH183 was a gift from Markus Schmid (Addgene plasmid # 122856 ; http://n2t.net/addgene:122856 ; RRID:Addgene_122856) -
For your References section:
CRISPR-based tools for targeted transcriptional and epigenetic regulation in plants. Lee JE, Neumann M, Duro DI, Schmid M. PLoS One. 2019 Sep 26;14(9):e0222778. doi: 10.1371/journal.pone.0222778. eCollection 2019. 10.1371/journal.pone.0222778 PubMed 31557222