Skip to main content

pMH183
(Plasmid #122856)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 122856 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 122856-D50 50 μg of DNA in Tris buffer $495
DNA 122856-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pMA-RQ
  • Backbone size w/o insert (bp) 2421
  • Total vector size (bp) 2703
  • Vector type
    Golden Gate compatible cloning vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MS2-modified sgRNA targeting the Arabidopsis FT promoter
  • gRNA/shRNA sequence
    ggatttgcattaactcgggt
  • Species
    Synthetic

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid is designed for Golden Gate cloning using the enzyme BsaI.

Plasmid Features (listed as bp in full plasmid sequence):
BsaI site #1 = 2241-2246bp
sgRNA-FT-A sequence = 2382-2541bp
BsaI site #2 = 2553-2558bp

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMH183 was a gift from Markus Schmid (Addgene plasmid # 122856 ; http://n2t.net/addgene:122856 ; RRID:Addgene_122856)
  • For your References section:

    CRISPR-based tools for targeted transcriptional and epigenetic regulation in plants. Lee JE, Neumann M, Duro DI, Schmid M. PLoS One. 2019 Sep 26;14(9):e0222778. doi: 10.1371/journal.pone.0222778. eCollection 2019. 10.1371/journal.pone.0222778 PubMed 31557222