pMH183
(Plasmid
#122856)
-
PurposeMS2-modified guide RNA targeting the FT promoter with GreenGate D-E flanking sequences
-
Depositing Lab
-
Depositing OrganizationUmea University
Located in Sweden -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 122856 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 122856-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 122856-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepMA-RQ
- Backbone size w/o insert (bp) 2421
- Total vector size (bp) 2703
-
Vector typeGolden Gate compatible cloning vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMS2-modified sgRNA targeting the Arabidopsis FT promoter
-
gRNA/shRNA sequenceggatttgcattaactcgggt
-
SpeciesSynthetic
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid is designed for Golden Gate cloning using the enzyme BsaI.
Plasmid Features (listed as bp in full plasmid sequence):
BsaI site #1 = 2241-2246bp
sgRNA-FT-A sequence = 2382-2541bp
BsaI site #2 = 2553-2558bp
DNA (Catalog # 122856-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 122856-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMH183 was a gift from Markus Schmid (Addgene plasmid # 122856 ; http://n2t.net/addgene:122856 ; RRID:Addgene_122856) -
For your References section:
CRISPR-based tools for targeted transcriptional and epigenetic regulation in plants. Lee JE, Neumann M, Duro DI, Schmid M. PLoS One. 2019 Sep 26;14(9):e0222778. doi: 10.1371/journal.pone.0222778. eCollection 2019. 10.1371/journal.pone.0222778 PubMed 31557222
