-
Depositing Lab
-
Depositing OrganizationScripps California (The Scripps Research Institute)
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 12287 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 12287-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 12287-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCMV
- Backbone size w/o insert (bp) 4700
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMyD88
-
SpeciesH. sapiens (human)
-
Insert Size (bp)891
-
Entrez GeneMYD88 (a.k.a. IMD68, MYD88D, WM1)
-
Tag
/ Fusion Protein
- HA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Not I (not destroyed)
- 3′ cloning site Sal I (not destroyed)
- 5′ sequencing primer ggatcctatccatatgacgtt
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene's sequencing results indicate the MyD88 insert starts at aa15 when compared to GenBank reference sequence NP_002459.2 (MyD88 isoform 2)
DNA (Catalog # 12287-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 12287-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-HA-MyD88 was a gift from Bruce Beutler (Addgene plasmid # 12287 ; http://n2t.net/addgene:12287 ; RRID:Addgene_12287) -
For your References section:
Details of Toll-like receptor:adapter interaction revealed by germ-line mutagenesis. Jiang Z, Georgel P, Li C, Choe J, Crozat K, Rutschmann S, Du X, Bigby T, Mudd S, Sovath S, Wilson IA, Olson A, Beutler B. Proc Natl Acad Sci U S A. 2006 Jul 18. 103(29):10961-6. 10.1073/pnas.0603804103 PubMed 16832055