Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #12287)


Item Catalog # Description Quantity Price (USD)
Plasmid 12287 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    MYD88 (a.k.a. IMD68, MYD88D)
  • Tag / Fusion Protein
    • HA (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Not I (not destroyed)
  • 3′ cloning site Sal I (not destroyed)
  • 5′ sequencing primer ggatcctatccatatgacgtt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Addgene's sequencing results indicate the MyD88 insert starts at aa15 when compared to GenBank reference sequence NP_002459.2 (MyD88 isoform 2)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-HA-MyD88 was a gift from Bruce Beutler (Addgene plasmid # 12287 ; ; RRID:Addgene_12287)
  • For your References section:

    Details of Toll-like receptor:adapter interaction revealed by germ-line mutagenesis. Jiang Z, Georgel P, Li C, Choe J, Crozat K, Rutschmann S, Du X, Bigby T, Mudd S, Sovath S, Wilson IA, Olson A, Beutler B. Proc Natl Acad Sci U S A. 2006 Jul 18. 103(29):10961-6. 10.1073/pnas.0603804103 PubMed 16832055