pCMV-HA-MyD88-I179N
(Plasmid
#12295)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 12295 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV
- Backbone size w/o insert (bp) 4700
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMyD88
-
SpeciesH. sapiens (human)
-
Insert Size (bp)891
-
MutationI179N
-
Entrez GeneMYD88 (a.k.a. IMD68, MYD88D, WM1)
-
Tag
/ Fusion Protein
- HA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Not I (not destroyed)
- 3′ cloning site Sal I (not destroyed)
- 5′ sequencing primer ggatcctatccatatgacgtt (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene's sequencing results indicate the MyD88 insert starts at aa15 when compared to GenBank reference sequence NP_002459.2 (MyD88 isoform 2). When numbered according to this reference sequence, the MyD88 mutation is I192N.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-HA-MyD88-I179N was a gift from Bruce Beutler (Addgene plasmid # 12295 ; http://n2t.net/addgene:12295 ; RRID:Addgene_12295) -
For your References section:
Details of Toll-like receptor:adapter interaction revealed by germ-line mutagenesis. Jiang Z, Georgel P, Li C, Choe J, Crozat K, Rutschmann S, Du X, Bigby T, Mudd S, Sovath S, Wilson IA, Olson A, Beutler B. Proc Natl Acad Sci U S A. 2006 Jul 18. 103(29):10961-6. 10.1073/pnas.0603804103 PubMed 16832055