pCALNL-BsaI-EGFP
(Plasmid
#123136)
-
PurposeGolden Gate acceptor vector for the assembly of EGFP-based mammalian recombinase reporters.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 123136 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCANLN
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 6500
-
Vector typeMammalian Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Mach1
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP, mRFP
-
Insert Size (bp)1000
- Promoter cBA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Esp3I (destroyed during cloning)
- 3′ cloning site Esp3I (destroyed during cloning)
- 5′ sequencing primer TCTGCTAACCATGTTCATGCCTTCTTCTTT
- 3′ sequencing primer CCGTCGACTGCAGAATTCAATTTAAATCGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Golden gate acceptor vector which, in conjunction with pBT100-neo donor vector and two dsDNA recombinase targets, assembles to form a fluorescent EGFP transfectable reporter. Acceptor vector has mRFP dropout cassette for ease of visualizing transformants that have received the donor cassette (white colonies).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCALNL-BsaI-EGFP was a gift from David Liu (Addgene plasmid # 123136 ; http://n2t.net/addgene:123136 ; RRID:Addgene_123136) -
For your References section:
High-resolution specificity profiling and off-target prediction for site-specific DNA recombinases. Bessen JL, Afeyan LK, Dancik V, Koblan LW, Thompson DB, Leichner C, Clemons PA, Liu DR. Nat Commun. 2019 Apr 26;10(1):1937. doi: 10.1038/s41467-019-09987-0. 10.1038/s41467-019-09987-0 PubMed 31028261