This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

SiriusGFP
(Plasmid #123201)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 123201 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone size w/o insert (bp) 4016
  • Total vector size (bp) 4733
  • Modifications to backbone
    N/A
  • Vector type
    Mammalian Expression, Bacterial Expression, Mouse Targeting

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SiriusGFP
  • Alt name
    SiriusGFP-N1
  • Species
    jellyfish
  • Insert Size (bp)
    717
  • Mutation
    eGFP-S30R/Y39N/F99S/N105T/S147R/M153T/V163A/S205V/A206K
  • Promoter CMV
  • Tags / Fusion Proteins
    • N/A
    • N/A

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI, BamHI, AgeI, etc. (not destroyed)
  • 3′ cloning site NotI, MfeI (not destroyed)
  • 5′ sequencing primer GGTTTAGTGAACCGTCAGATCC
  • 3′ sequencing primer TGTTTCAGGTTCAGGG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SiriusGFP was a gift from Joseph Santos-Sacchi (Addgene plasmid # 123201 ; http://n2t.net/addgene:123201 ; RRID:Addgene_123201)
  • For your References section:

    Seeing the long tail: A novel green fluorescent protein, SiriusGFP, for ultra long timelapse imaging. Zhong S, Rivera-Molina F, Rivetta A, Toomre D, Santos-Sacchi J, Navaratnam D. J Neurosci Methods. 2019 Feb 1;313:68-76. doi: 10.1016/j.jneumeth.2018.12.008. Epub 2018 Dec 19. 10.1016/j.jneumeth.2018.12.008 PubMed 30578868