Skip to main content

SiriusGFP
(Plasmid #123201)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 123201 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 123201-D50 50 μg of DNA in Tris buffer $495
DNA 123201-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone size w/o insert (bp) 4016
  • Total vector size (bp) 4733
  • Modifications to backbone
    N/A
  • Vector type
    Mammalian Expression, Bacterial Expression, Mouse Targeting

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SiriusGFP
  • Alt name
    SiriusGFP-N1
  • Species
    jellyfish
  • Insert Size (bp)
    717
  • Mutation
    eGFP-S30R/Y39N/F99S/N105T/S147R/M153T/V163A/S205V/A206K
  • Promoter CMV
  • Tags / Fusion Proteins
    • N/A
    • N/A

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI, BamHI, AgeI, etc. (not destroyed)
  • 3′ cloning site NotI, MfeI (not destroyed)
  • 5′ sequencing primer GGTTTAGTGAACCGTCAGATCC
  • 3′ sequencing primer TGTTTCAGGTTCAGGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SiriusGFP was a gift from Joseph Santos-Sacchi (Addgene plasmid # 123201 ; http://n2t.net/addgene:123201 ; RRID:Addgene_123201)
  • For your References section:

    Seeing the long tail: A novel green fluorescent protein, SiriusGFP, for ultra long timelapse imaging. Zhong S, Rivera-Molina F, Rivetta A, Toomre D, Santos-Sacchi J, Navaratnam D. J Neurosci Methods. 2019 Feb 1;313:68-76. doi: 10.1016/j.jneumeth.2018.12.008. Epub 2018 Dec 19. 10.1016/j.jneumeth.2018.12.008 PubMed 30578868