pCMV-MA-VN
(Plasmid
#123283)
-
PurposeMammalian expression plasmid for matrix domain of HIV-1 Gag fused to the N-terminal half of split fluorescent Venus (VN)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 123283 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV
-
Backbone manufacturerNIH AIDS Reagent Program (Cat. No. 11468)
- Backbone size w/o insert (bp) 3970
- Total vector size (bp) 4866
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMatrix
-
Alt nameGag p17
-
Alt namep17
-
Alt nameMA
-
SpeciesHuman immunodeficiency virus 1
-
Insert Size (bp)896
-
GenBank IDNP_579876.2
- Promoter CMV
-
Tag
/ Fusion Protein
- VN: N-terminus of split Venus (a.a. V1–A154) I152L variant (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CMV forward: CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer SV40-pArev: CCTCTACAAATGTGGTATGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-MA-VN was a gift from Erik Procko (Addgene plasmid # 123283 ; http://n2t.net/addgene:123283 ; RRID:Addgene_123283) -
For your References section:
Conformational engineering of HIV-1 Env based on mutational tolerance in the CD4 and PG16 bound states. Heredia JD, Park J, Choi H, Gill KS, Procko E. J Virol. 2019 Mar 20. pii: JVI.00219-19. doi: 10.1128/JVI.00219-19. 10.1128/JVI.00219-19 PubMed 30894475