Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-Syn-ChromeQ-GFP
(Plasmid #123317)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 123317 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-Syn
  • Backbone manufacturer
    original from Stratagene
  • Backbone size w/o insert (bp) 4708
  • Total vector size (bp) 6373
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Can use DH5alpha at 37°C or Stbl3 at 30°C. Carbenicillin is preferred over ampicillin. In DH5alpha this plasmid may act more like a high copy plasmid, although in Stbl3 it may act more like a low copy plasmid.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ChromeQ-GFP
  • Insert Size (bp)
    1665
  • Mutation
    Channelrhodopsin-2 (ChR2) with mutations A71S/ E90A/H114G/R115S
  • Promoter Syn
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site ECoRI (not destroyed)
  • 5′ sequencing primer gcacgggcgcgaccatctgc
  • 3′ sequencing primer TAGCGTAAAAGGAGCAACATAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The plasmid is fully sequenced in the coding sequence regions (opsin-fluorophore and important flanking regions). Multiple digestions were done to verify the vector structure. The construct and the virus were both tested in vitro.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Syn-ChromeQ-GFP was a gift from Edward Boyden (Addgene plasmid # 123317 ; http://n2t.net/addgene:123317 ; RRID:Addgene_123317)
  • For your References section:

    Multidimensional screening yields channelrhodopsin variants having improved photocurrent and order-of-magnitude reductions in calcium and proton currents. Cho YK, Park D, Yang A, Chen F, Chuong AS, Klapoetke NC, Boyden ES. J Biol Chem. 2019 Jan 4. pii: RA118.006996. doi: 10.1074/jbc.RA118.006996. 10.1074/jbc.RA118.006996 PubMed 30610117