pDB-His-MBP-mGSDMD
(Plasmid
#123365)
-
PurposeExpression of full-length mouse GSDMD in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 123365 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDB-His-MBP
-
Backbone manufacturerBerkeley Structural Genomics Center
- Backbone size w/o insert (bp) 6494
- Total vector size (bp) 7958
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGSDMD
-
Alt nameGasdermin D
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1464
-
GenBank IDNP_081236.1
-
Entrez GeneGsdmd (a.k.a. 1810036L03Rik, DF5L, Dfna5l, GsdmD-1, Gsdmdc1, M2-4)
- Promoter T7
-
Tag
/ Fusion Protein
- His6-MBP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer CAGATGTCCGCTTTCTGGTATGCCG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDB-His-MBP-mGSDMD was a gift from Hao Wu (Addgene plasmid # 123365 ; http://n2t.net/addgene:123365 ; RRID:Addgene_123365) -
For your References section:
Pathogen blockade of TAK1 triggers caspase-8-dependent cleavage of gasdermin D and cell death. Orning P, Weng D, Starheim K, Ratner D, Best Z, Lee B, Brooks A, Xia S, Wu H, Kelliher MA, Berger SB, Gough PJ, Bertin J, Proulx MM, Goguen JD, Kayagaki N, Fitzgerald KA, Lien E. Science. 2018 Nov 30;362(6418):1064-1069. doi: 10.1126/science.aau2818. Epub 2018 Oct 25. 10.1126/science.aau2818 PubMed 30361383