Skip to main content

pcDNA6-N-3XFLAG-Fzd6
(Plasmid #123588)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 123588 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA6
  • Backbone size w/o insert (bp) 5079
  • Total vector size (bp) 7209
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    frizzled class receptor 6
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2130
  • GenBank ID
    NM_008056.3
  • Entrez Gene
    Fzd6 (a.k.a. Fz6)
  • Tag / Fusion Protein
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA6-N-3XFLAG-Fzd6 was a gift from Bruce Beutler (Addgene plasmid # 123588 ; http://n2t.net/addgene:123588 ; RRID:Addgene_123588)
  • For your References section:

    LMBR1L regulates lymphopoiesis through Wnt/beta-catenin signaling. Choi JH, Zhong X, McAlpine W, Liao TC, Zhang D, Fang B, Russell J, Ludwig S, Nair-Gill E, Zhang Z, Wang KW, Misawa T, Zhan X, Choi M, Wang T, Li X, Tang M, Sun Q, Yu L, Murray AR, Moresco EMY, Beutler B. Science. 2019 May 10;364(6440). pii: 364/6440/eaau0812. doi: 10.1126/science.aau0812. 10.1126/science.aau0812 PubMed 31073040