Cx36-GCaMP
(Plasmid
#123604)
-
PurposeMouse Connexin 36-GCaMP3 fusion for measuring gap junction localized calcium signaling - expresses in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 123604 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3800
- Total vector size (bp) 6335
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameConnexin 36-GCaMP3 fusion
-
Alt nameCx36-GCaMP
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2513
-
Entrez GeneGjd2 (a.k.a. Cxns, Gja9, connexin36, cx36)
- Promoter CMV
-
Tag
/ Fusion Protein
- GCaMP3 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AfeI (destroyed during cloning)
- 3′ cloning site BglII (destroyed during cloning)
- 5′ sequencing primer CMV forward (CGCAAATGGGCGGTAGGCGTG)
- 3′ sequencing primer GCaMP Rev (TGATGCCGTTCTTCTGCTTGTC)
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byMuayyad Al-Ubaidi, University of Illinois, Chicago (currently University of Houston) GCaMP3 from Loren Looger (Addgene plasmid #22692)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cx36-GCaMP was a gift from John O'Brien (Addgene plasmid # 123604 ; http://n2t.net/addgene:123604 ; RRID:Addgene_123604) -
For your References section:
Localized calcium signaling and the control of coupling at Cx36 gap junctions. Moore KB, Mitchell CK, Lin YP, Lee YH, Shihabeddin E, O'Brien J. eNeuro. 2020 Mar 11. pii: ENEURO.0445-19.2020. doi: 10.1523/ENEURO.0445-19.2020. 10.1523/ENEURO.0445-19.2020 PubMed 32179580