NLS-nCas9-NLS-P2A-EGFP (pRZ70)
(Plasmid
#123616)
-
PurposeCMV promoter expression plasmid for codon-optimized bpNLS-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP (ABEmax control without TadA domains).
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 123616 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCMV
-
Backbone manufacturerpCMV-BE1 (Addgene #73019)
- Backbone size w/o insert (bp) 3399
- Total vector size (bp) 8535
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLS-nCas9-NLS-P2A-EGFP
-
Alt namebpNLS-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP
-
SpeciesSynthetic; Streptococcus pyogenes
-
Insert Size (bp)5136
-
MutationD10A in SpCas9
-
GenBank ID
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byLiu Lab (ABEmax-P2A-EGFP, Addgene #112101)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
NLS-nCas9-NLS-P2A-EGFP (pRZ70) was a gift from Keith Joung (Addgene plasmid # 123616 ; http://n2t.net/addgene:123616 ; RRID:Addgene_123616) -
For your References section:
Transcriptome-wide off-target RNA editing induced by CRISPR-guided DNA base editors. Grunewald J, Zhou R, Garcia SP, Iyer S, Lareau CA, Aryee MJ, Joung JK. Nature. 2019 Apr 17. pii: 10.1038/s41586-019-1161-z. doi: 10.1038/s41586-019-1161-z. 10.1038/s41586-019-1161-z PubMed 30995674