Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

NLS-nCas9-NLS-P2A-EGFP (pRZ70)
(Plasmid #123616)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 123616 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    CMV
  • Backbone manufacturer
    pCMV-BE1 (Addgene #73019)
  • Backbone size w/o insert (bp) 3399
  • Total vector size (bp) 8535
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NLS-nCas9-NLS-P2A-EGFP
  • Alt name
    bpNLS-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP
  • Species
    Synthetic; Streptococcus pyogenes
  • Insert Size (bp)
    5136
  • Mutation
    D10A in SpCas9
  • GenBank ID
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Liu Lab (ABEmax-P2A-EGFP, Addgene #112101)
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    NLS-nCas9-NLS-P2A-EGFP (pRZ70) was a gift from Keith Joung (Addgene plasmid # 123616 ; http://n2t.net/addgene:123616 ; RRID:Addgene_123616)
  • For your References section:

    Transcriptome-wide off-target RNA editing induced by CRISPR-guided DNA base editors. Grunewald J, Zhou R, Garcia SP, Iyer S, Lareau CA, Aryee MJ, Joung JK. Nature. 2019 Apr 17. pii: 10.1038/s41586-019-1161-z. doi: 10.1038/s41586-019-1161-z. 10.1038/s41586-019-1161-z PubMed 30995674