pSLHDR02_EGFP_tCD8
(Plasmid
#124061)
-
PurposeConstruction of 1st donor for scarless genome editing
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124061 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneOriginal
- Backbone size w/o insert (bp) 2440
- Total vector size (bp) 5503
-
Vector typeMouse Targeting ; Human Targeting
-
Selectable markersGFP, tCD8
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameEGFP
-
SpeciesAequorea victoria
-
Insert Size (bp)708
- Promoter Human UbC promoter modified
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CAGTGTTAGACTAGTAAATTGTCCGC
- 3′ sequencing primer TCAAGTCCGCCATGCCCGAA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nametCD8
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)627
- Promoter Human UbC promoter modified
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer TGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer ccctcATTCTTGGGGTTGAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLHDR02_EGFP_tCD8 was a gift from Matthew Porteus (Addgene plasmid # 124061 ; http://n2t.net/addgene:124061 ; RRID:Addgene_124061) -
For your References section:
Efficient scarless genome editing in human pluripotent stem cells. Ikeda K, Uchida N, Nishimura T, White J, Martin RM, Nakauchi H, Sebastiano V, Weinberg KI, Porteus MH. Nat Methods. 2018 Dec;15(12):1045-1047. doi: 10.1038/s41592-018-0212-y. Epub 2018 Nov 30. 10.1038/s41592-018-0212-y PubMed 30504872