Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pEW65: pQE-81L H3(K79M)
(Plasmid #124100)


Item Catalog # Description Quantity Price (USD)
Plasmid 124100 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4663
  • Total vector size (bp) 5074
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    Histone H3
  • Species
    X. laevis (frog)
  • Mutation
  • Entrez Gene
  • Promoter T5

Cloning Information

  • Cloning method Gibson Cloning
  • 3′ sequencing primer ATTCTCACCAATAAAAAACGCCCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEW65: pQE-81L H3(K79M) was a gift from Cynthia Wolberger (Addgene plasmid # 124100 ; ; RRID:Addgene_124100)
  • For your References section:

    Mechanism of Cross-talk between H2B Ubiquitination and H3 Methylation by Dot1L. Worden EJ, Hoffmann NA, Hicks CW, Wolberger C. Cell. 2019 Feb 8. pii: S0092-8674(19)30151-5. doi: 10.1016/j.cell.2019.02.002. 10.1016/j.cell.2019.02.002 PubMed 30765112