pEW65: pQE-81L H3(K79M)
(Plasmid
#124100)
-
PurposeH3K79M expression plasmid for norleucine supplementation
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124100 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepQE-81L
- Backbone size w/o insert (bp) 4663
- Total vector size (bp) 5074
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHistone H3
-
SpeciesX. laevis (frog)
-
MutationK79M
-
Entrez GeneLOC108704296
- Promoter T5
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCATAAAAAATTTATTTGCTTTGTGAGCGG
- 3′ sequencing primer ATTCTCACCAATAAAAAACGCCCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEW65: pQE-81L H3(K79M) was a gift from Cynthia Wolberger (Addgene plasmid # 124100 ; http://n2t.net/addgene:124100 ; RRID:Addgene_124100) -
For your References section:
Mechanism of Cross-talk between H2B Ubiquitination and H3 Methylation by Dot1L. Worden EJ, Hoffmann NA, Hicks CW, Wolberger C. Cell. 2019 Feb 8. pii: S0092-8674(19)30151-5. doi: 10.1016/j.cell.2019.02.002. 10.1016/j.cell.2019.02.002 PubMed 30765112