-
PurposePolycistronic coexpression of Xenopus laevis histones (H2A, H2B, H3 and H4)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 66890 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET29a
- Backbone size w/o insert (bp) 5371
- Total vector size (bp) 6983
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameHis6-Thrombin-Xenopus laevis histones H2A
-
SpeciesX. laevis (frog)
-
Insert Size (bp)498
- Promoter T7
-
Tags
/ Fusion Proteins
- His6 tag
- Thrombin
- H2A
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TCGGCCAAGAGCAAGTGAGAATTC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameXenopus laevis histones H2B
-
SpeciesX. laevis (frog)
-
Insert Size (bp)372
- Promoter T7
-
Tag
/ Fusion Protein
- H2B
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GAATTCAATAATTTTGTTTAACTT
- 3′ sequencing primer GTCGACTTACTTGGCGCTGGTGTA (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameXenopus laevis histones H3
-
SpeciesX. laevis (frog)
-
Insert Size (bp)411
- Promoter T7
-
Tag
/ Fusion Protein
- H3
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GTCGACAATAATTTTGTTTAACTT
- 3′ sequencing primer GCGGCCGCCTAAGCCCTCTCGCCTCG (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameXenopus laevis histones H4-Thrombin
-
SpeciesX. laevis (frog)
-
Insert Size (bp)363
- Promoter T7
-
Tags
/ Fusion Proteins
- H4
- Thrombin
Cloning Information for Gene/Insert 4
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GCGGCCGCAATAATTTTGTTTAACTT
- 3′ sequencing primer CTCGAGGCTGCCGCGCGGCACCAGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byB. Bartholomew and K. Luger
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET29a-YS14 was a gift from Jung-Hyun Min (Addgene plasmid # 66890 ; http://n2t.net/addgene:66890 ; RRID:Addgene_66890) -
For your References section:
Polycistronic coexpression and nondenaturing purification of histone octamers. Shim Y, Duan MR, Chen X, Smerdon MJ, Min JH. Anal Biochem. 2012 Aug 15;427(2):190-2. doi: 10.1016/j.ab.2012.05.006. Epub 2012 May 19. 10.1016/j.ab.2012.05.006 PubMed 22617796