Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pET29a-YS14
(Plasmid #66890)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 66890 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET29a
  • Backbone size w/o insert (bp) 5371
  • Total vector size (bp) 6983
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    His6-Thrombin-Xenopus laevis histones H2A
  • Species
    X. laevis (frog)
  • Insert Size (bp)
    498
  • Promoter T7
  • Tags / Fusion Proteins
    • His6 tag
    • Thrombin
    • H2A

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TCGGCCAAGAGCAAGTGAGAATTC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Xenopus laevis histones H2B
  • Species
    X. laevis (frog)
  • Insert Size (bp)
    372
  • Promoter T7
  • Tag / Fusion Protein
    • H2B

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GAATTCAATAATTTTGTTTAACTT
  • 3′ sequencing primer GTCGACTTACTTGGCGCTGGTGTA
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    Xenopus laevis histones H3
  • Species
    X. laevis (frog)
  • Insert Size (bp)
    411
  • Promoter T7
  • Tag / Fusion Protein
    • H3

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GTCGACAATAATTTTGTTTAACTT
  • 3′ sequencing primer GCGGCCGCCTAAGCCCTCTCGCCTCG
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    Xenopus laevis histones H4-Thrombin
  • Species
    X. laevis (frog)
  • Insert Size (bp)
    363
  • Promoter T7
  • Tags / Fusion Proteins
    • H4
    • Thrombin

Cloning Information for Gene/Insert 4

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GCGGCCGCAATAATTTTGTTTAACTT
  • 3′ sequencing primer CTCGAGGCTGCCGCGCGGCACCAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    B. Bartholomew and K. Luger
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET29a-YS14 was a gift from Jung-Hyun Min (Addgene plasmid # 66890 ; http://n2t.net/addgene:66890 ; RRID:Addgene_66890)
  • For your References section:

    Polycistronic coexpression and nondenaturing purification of histone octamers. Shim Y, Duan MR, Chen X, Smerdon MJ, Min JH. Anal Biochem. 2012 Aug 15;427(2):190-2. doi: 10.1016/j.ab.2012.05.006. Epub 2012 May 19. 10.1016/j.ab.2012.05.006 PubMed 22617796