-
PurposeSpCas9-NLS 17 amino acid linker to monoavidin (SpCas9-NLS-MAV)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 124212 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEC-K-MBP
- Backbone size w/o insert (bp) 5745
- Total vector size (bp) 10990
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namecas9
-
Alt nameCsn1
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)5745
- Promoter T7
-
Tags
/ Fusion Proteins
- MBP (N terminal on backbone)
- His6 (N terminal on backbone)
- two copies of SV40NLS (C terminal on insert)
- TEV Cleavage site (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GATGAAGCCCTGAAAGACGCGCAG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypRSET-mSA (which we bought from Addgene), and pMJ915 and pMJ806 (which we got from our collaborator at McGill). All three of them contributed to the final plasmid.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
spCas9-NLS-MAV was a gift from Uri David Akavia (Addgene plasmid # 124212 ; http://n2t.net/addgene:124212 ; RRID:Addgene_124212) -
For your References section:
Double-Stranded Biotinylated Donor Enhances Homology-Directed Repair in Combination with Cas9 Monoavidin in Mammalian Cells. Roche PJR, Gytz H, Hussain F, Cameron CJF, Paquette D, Blanchette M, Dostie J, Nagar B, Akavia UD. CRISPR J. 2018 Dec;1:414-430. doi: 10.1089/crispr.2018.0045. 10.1089/crispr.2018.0045 PubMed 31021244