-
PurposepX330 vector carrying spCas9-mSA for gene editing in mammalian cell lines
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113096 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepX330
-
Backbone manufacturerFeng Zhang's Lab
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCAS9-MSA
-
Speciessynthetic
-
Insert Size (bp)4818
-
Mutationnone
-
Tag
/ Fusion Protein
- MSA (monomeric streptavidin (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggatggttggttggtggggtatta
- 3′ sequencing primer TAG AAG GCA CAG TCG AGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330 spCas9-mSA was a gift from Janet Rossant (Addgene plasmid # 113096 ; http://n2t.net/addgene:113096 ; RRID:Addgene_113096) -
For your References section:
Efficient generation of targeted large insertions by microinjection into two-cell-stage mouse embryos. Gu B, Posfai E, Rossant J. Nat Biotechnol. 2018 Jun 11. pii: nbt.4166. doi: 10.1038/nbt.4166. 10.1038/nbt.4166 PubMed 29889212