PCS2+Cas9-mSA
(Plasmid #103882)

• Purpose: Cas9 mSA for in vitro transcription for gene editing in Mouse Embryos
• Depositing Lab: Janet Rossant
• Publication: Gu et al Nat Biotechnol. 2018 Jun 11. pii: nbt.4166. doi: 10.1038/nbt.4166.

Backbone

• Vector backbone: PCS2+
• Backbone size w/o insert (bp): 4072
• Total vector size (bp): 8886
• Modifications to backbone: none
• Vector type: CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: none
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CAS9-MSA
• Species: synthetic
• Insert Size (bp): 4818
• Mutation: none
• Promoter: SP6
• Tag / Fusion Protein:
  • MSA (monomeric streptavidin (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Kpn1 (not destroyed)
• 3′ cloning site: destroyed (unknown if destroyed)
• 5′ sequencing primer: ATTTAGGTGACACTAT
• 3′ sequencing primer: CCTGTGTGAAATTGTTATCC

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: We cloned this gene ourselves. But we used Cas9 sequence from px330 plasmid from add gene and the MSA sequence from pDisplay-mSA-EGFP-TM (Plasmid #39863)
• Articles Citing this Plasmid:
  • 8 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

non