Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

EasyFusion T2A-H2B-mCherry
(Plasmid #113089)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 113089 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pbluescript
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    T2A-H2B-mCherry
  • Species
    Synthetic

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CACACAGGAAACAGCTATGAC
  • 3′ sequencing primer CGCAACTGTTGGGAAGGGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EasyFusion T2A-H2B-mCherry was a gift from Janet Rossant (Addgene plasmid # 113089 ; http://n2t.net/addgene:113089 ; RRID:Addgene_113089)
  • For your References section:

    Efficient generation of targeted large insertions by microinjection into two-cell-stage mouse embryos. Gu B, Posfai E, Rossant J. Nat Biotechnol. 2018 Jun 11. pii: nbt.4166. doi: 10.1038/nbt.4166. 10.1038/nbt.4166 PubMed 29889212