Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

spCas9-NLS-MAV
(Plasmid #124212)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 124212 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEC-K-MBP
  • Backbone size w/o insert (bp) 5745
  • Total vector size (bp) 10990
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    cas9
  • Alt name
    Csn1
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    5745
  • Promoter T7
  • Tags / Fusion Proteins
    • MBP (N terminal on backbone)
    • His6 (N terminal on backbone)
    • two copies of SV40NLS (C terminal on insert)
    • TEV Cleavage site (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GATGAAGCCCTGAAAGACGCGCAG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    pRSET-mSA (which we bought from Addgene), and pMJ915 and pMJ806 (which we got from our collaborator at McGill). All three of them contributed to the final plasmid.
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    spCas9-NLS-MAV was a gift from Uri David Akavia (Addgene plasmid # 124212 ; http://n2t.net/addgene:124212 ; RRID:Addgene_124212)
  • For your References section:

    Double-Stranded Biotinylated Donor Enhances Homology-Directed Repair in Combination with Cas9 Monoavidin in Mammalian Cells. Roche PJR, Gytz H, Hussain F, Cameron CJF, Paquette D, Blanchette M, Dostie J, Nagar B, Akavia UD. CRISPR J. 2018 Dec;1:414-430. doi: 10.1089/crispr.2018.0045. 10.1089/crispr.2018.0045 PubMed 31021244