Skip to main content
Addgene

pAT-9222
(Plasmid #124222)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124222 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAGGS
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    self-targeting gRNA between EGFP halves
  • Promoter CAG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CAACGTGCTGGTTATTGTGC
  • 3′ sequencing primer CCTCTGACTTGAGCGTCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAT-9222 was a gift from Ervin Welker (Addgene plasmid # 124222 ; http://n2t.net/addgene:124222 ; RRID:Addgene_124222)
  • For your References section:

    A method for characterizing Cas9 variants via a one-million target sequence library of self-targeting sgRNAs. Talas A, Huszar K, Kulcsar PI, Varga JK, Varga E, Toth E, Welker Z, Erdos G, Pach PF, Welker A, Gyorgypal Z, Tusnady GE, Welker E. Nucleic Acids Res. 2021 Jan 15. pii: 6101605. doi: 10.1093/nar/gkaa1220. 10.1093/nar/gkaa1220 PubMed 33450024