pAT-9222
(Plasmid
#124222)
-
PurposeCloning plasmid for EGxFP assay with self-targeting gRNA-s
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124222 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAGGS
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameself-targeting gRNA between EGFP halves
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAACGTGCTGGTTATTGTGC
- 3′ sequencing primer CCTCTGACTTGAGCGTCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAT-9222 was a gift from Ervin Welker (Addgene plasmid # 124222 ; http://n2t.net/addgene:124222 ; RRID:Addgene_124222) -
For your References section:
A method for characterizing Cas9 variants via a one-million target sequence library of self-targeting sgRNAs. Talas A, Huszar K, Kulcsar PI, Varga JK, Varga E, Toth E, Welker Z, Erdos G, Pach PF, Welker A, Gyorgypal Z, Tusnady GE, Welker E. Nucleic Acids Res. 2021 Jan 15. pii: 6101605. doi: 10.1093/nar/gkaa1220. 10.1093/nar/gkaa1220 PubMed 33450024