pAT-9251
(Plasmid
#124226)
-
PurposeBacterial SpCas9-HF1 expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124226 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonep15A
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSpCas9-HF1
-
SpeciesE. coli
- Promoter TetR/TetA
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGACCTCATTAAGCAGCTCT
- 3′ sequencing primer GAGGAAGCGGAATATATCCCTAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAT-9251 was a gift from Ervin Welker (Addgene plasmid # 124226 ; http://n2t.net/addgene:124226 ; RRID:Addgene_124226) -
For your References section:
A method for characterizing Cas9 variants via a one-million target sequence library of self-targeting sgRNAs. Talas A, Huszar K, Kulcsar PI, Varga JK, Varga E, Toth E, Welker Z, Erdos G, Pach PF, Welker A, Gyorgypal Z, Tusnady GE, Welker E. Nucleic Acids Res. 2021 Jan 15. pii: 6101605. doi: 10.1093/nar/gkaa1220. 10.1093/nar/gkaa1220 PubMed 33450024