Skip to main content

Thy-1-CRISPR-gRNA#3-(pSpCas9(BB)-2A-Puro (PX459) V2.0)
(Plasmid #124285)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124285 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-Puro (PX459) V2.0
  • Backbone manufacturer
    Feng Zhang (Addgene plasmid # 62988)
  • Backbone size w/o insert (bp) 9200
  • Vector type
    CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Homo sapiens Thy-1 cell surface antigen (THY1), transcript variant 1
  • Alt name
    CD90
  • gRNA/shRNA sequence
    (g)TAGCAGGAGAGCGATGCTGA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    21
  • Entrez Gene
    THY1 (a.k.a. CD90, CDw90)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer U6-fw: GGGCCTATTTCCCATGATTCCTTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plus "G" was routinely added because U6 promoter prefers "G" as the first transcribed nucleotide. gRNA sequence contains at least 3 mismatches, and was selected by choosing the highest scored sequence from different programs and databases.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Thy-1-CRISPR-gRNA#3-(pSpCas9(BB)-2A-Puro (PX459) V2.0) was a gift from Katalin Josvay & Csaba Vizler (Addgene plasmid # 124285 ; http://n2t.net/addgene:124285 ; RRID:Addgene_124285)