pBHSTC104
(Plasmid
#124356)
-
PurposePlasmid expressing N- and C-terminal split fragments of gp41-1 intein inserted into CcdA antitoxin
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 124356 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSTC3.1
-
Backbone manufacturerDelphi Genetics
- Backbone size w/o insert (bp) 2586
- Total vector size (bp) 3002
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namegp41-1 N-intein and C-intein (bicistronic)
-
Speciesmetagenomic
-
Insert Size (bp)416
-
GenBank IDAACY020177900
- Promoter STC
-
Tag
/ Fusion Protein
- CcdA-C (SFAD) (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TGAGGTCGCCCGGTTTATTG
- 3′ sequencing primer TGCAGCGCGTTAGAATAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBHSTC104 was a gift from Hideo Iwai (Addgene plasmid # 124356 ; http://n2t.net/addgene:124356 ; RRID:Addgene_124356) -
For your References section:
Off-pathway-sensitive protein splicing screening based on a toxin/antitoxin system. Beyer HM, Iwai H. Chembiochem. 2019 Apr 8. doi: 10.1002/cbic.201900139. 10.1002/cbic.201900139 PubMed 30963690