pSPgRNA_BLK_P4
(Plasmid
#124458)
-
PurposeFor CRISPR-mediated epigenome editing of human BLK gene locus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 124458 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSPgRNA (Addgene #47108)
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBLK_P4_gRNA
-
Alt nameBLK_LA55
-
gRNA/shRNA sequenceATAATGGAGGTAACGGGAGA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
-
Entrez GeneBLK (a.k.a. MODY11)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer hU6-F
- 3′ sequencing primer T3
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSPgRNA_BLK_P4 was a gift from Iouri Chepelev (Addgene plasmid # 124458 ; http://n2t.net/addgene:124458 ; RRID:Addgene_124458) -
For your References section:
Haplotype-specific chromatin looping reveals genetic interactions of regulatory regions modulating gene expression in 8p23.1. Saint Just Ribeiro M, Tripathi P, Namjou B, Harley JB, Chepelev I. Front Genet. 2022 Sep 7;13:1008582. doi: 10.3389/fgene.2022.1008582. eCollection 2022. 10.3389/fgene.2022.1008582 PubMed 36160011