hKCNB1 G381R
(Plasmid
#124490)
-
Purposemissense mutation in children with EOEE. HA tagged in C-terminus, pCIneo vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124490 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepHA-CIneo (Promega’s pCI-neo vector modified with a HA-tag)
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehuman KCNB1
-
SpeciesH. sapiens (human)
-
Mutationchanged glycine at 381 to arginine
-
Entrez GeneKCNB1 (a.k.a. DRK1, Kv2.1)
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer agctgaattccaccatgccggcgggcatgacg
- 3′ sequencing primer TGGGTAGAATTCGATGCTCTGATCTCGTGTGCTTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hKCNB1 G381R was a gift from Federico Sesti (Addgene plasmid # 124490 ; http://n2t.net/addgene:124490 ; RRID:Addgene_124490) -
For your References section:
Complexes formed with integrin-alpha5 and KCNB1 potassium channel wild type or epilepsy-susceptibility variants modulate cellular plasticity via Ras and Akt signaling. Yu W, Shin MR, Sesti F. FASEB J. 2019 Dec;33(12):14680-14689. doi: 10.1096/fj.201901792R. Epub 2019 Nov 2. 10.1096/fj.201901792R PubMed 31682765