Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

hKCNB1 G381R
(Plasmid #124490)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 124490 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHA-CIneo (Promega’s pCI-neo vector modified with a HA-tag)
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    human KCNB1
  • Species
    H. sapiens (human)
  • Mutation
    changed glycine at 381 to arginine
  • Entrez Gene
    KCNB1 (a.k.a. DRK1, Kv2.1)
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer agctgaattccaccatgccggcgggcatgacg
  • 3′ sequencing primer TGGGTAGAATTCGATGCTCTGATCTCGTGTGCTTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hKCNB1 G381R was a gift from Federico Sesti (Addgene plasmid # 124490 ; http://n2t.net/addgene:124490 ; RRID:Addgene_124490)
  • For your References section:

    Complexes formed with integrin-alpha5 and KCNB1 potassium channel wild type or epilepsy-susceptibility variants modulate cellular plasticity via Ras and Akt signaling. Yu W, Shin MR, Sesti F. FASEB J. 2019 Dec;33(12):14680-14689. doi: 10.1096/fj.201901792R. Epub 2019 Nov 2. 10.1096/fj.201901792R PubMed 31682765