MLRV2: NF-kb-SMAD-DBE-P53-AP1
(Plasmid #124536)

• Purpose: Multiplex luciferase reporter vector, with luciferase reporters for the pathways NFKB, SMAD, FOXO, P53 and AP1
• Depositing Lab: Koen Venken
• Publication: Sarrion-Perdigones et al Curr Protoc Mol Biol. 2020 Jun;131(1):e121. doi: 10.1002/cpmb.121.

Backbone

• Vector backbone: Omega Destination-CMV::ELuc:bGH
• Backbone manufacturer: Venken Lab, #124528
• Backbone size w/o insert (bp): 5000
• Total vector size (bp): 13636
• Vector type: Mammalian Expression, Luciferase, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: 5 copies of the NF-kb DNA binding motif
• Alt name: Transcription Blocker + 5 copies of the NF-kb DNA binding motif + miniP+ Red Firefly luciferase
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 2215

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: ACTCCACCCATTGACGTCAATGG
• 3′ sequencing primer: agaatggcgccgggcctttc

Gene/Insert 2

• Gene/Insert name: 7xSMAD_RE::FLuc
• Alt name: Transcription Blocker + 7 copies of the SMAD DNA binding motif + miniP+ Firefly luciferase
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 2276

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: CAAGAAGCCCGTGGCCAAGATG
• 3′ sequencing primer: CGGGGTCATAAACCTTGGAAGTCATTG

Gene/Insert 3

• Gene/Insert name: 3xDBE_BE::Renilla (FOXO)
• Alt name: Transcription Blocker + 3 copies of the DBE DNA binding motif + miniP + Renilla luciferase
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 1543

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: agggcggaaagatcgccgtg
• 3′ sequencing primer: CGAAGTCCTCCAAGGTAAACACCATTG

Gene/Insert 4

• Gene/Insert name: 2xP53_RE::NLuc
• Alt name: Transcription Blocker + 2 copies of the p53 DNA binding motif + miniP + NLuc luciferase
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 1088

Cloning Information for Gene/Insert 4

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: GTCCTGAAGAACGAACAGTGAGCTTC
• 3′ sequencing primer: CTGGGTCGTAGACTTTGGAAGCC

Gene/Insert 5

• Gene/Insert name: 6xAP-1_RE::GrRenilla
• Alt name: Transcription Blocker + 6 copies of the AP-1 DNA binding motif + miniP + GreenRenilla luciferase
• Insert Size (bp): 1514

Cloning Information for Gene/Insert 5

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (unknown if destroyed)
• 3′ cloning site: BsmBI (unknown if destroyed)
• 5′ sequencing primer: GAGGCTCTGCGAACGAATACTCG
• 3′ sequencing primer: ctt ttt acg gtt cct ggc ctt ttg

Resource Information

• Supplemental Documents:
  • MLRV2 NFkB-RedF_SMAD-Firefly_Foxo-Renilla_p53-NLuc_AP1-GR.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
  • NanoLuc Luciferase Limited Use Label License
  • Renilla Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry