GluR2_adRNA(1,20,6)-ADAR2(E488Q)
(Plasmid
#124621)
-
PurposeExpresses adRNA(1,20,6) targeting the RAB7A transcript along with the ADAR2(E488Q)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124621 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneUnknown
- Backbone size w/o insert (bp) 4700
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameADAR2(E488Q)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2106
-
MutationE488Q hyperactive mutant
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CMV Forward
- 3′ sequencing primer TCCTTCCGTGTTTCAGTTAGCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Also expresses 2 copies of GluR2_adRNA(1,20,6) from human and mouse U6 promoters
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GluR2_adRNA(1,20,6)-ADAR2(E488Q) was a gift from Prashant Mali (Addgene plasmid # 124621 ; http://n2t.net/addgene:124621 ; RRID:Addgene_124621) -
For your References section:
In vivo RNA editing of point mutations via RNA-guided adenosine deaminases. Katrekar D, Chen G, Meluzzi D, Ganesh A, Worlikar A, Shih YR, Varghese S, Mali P. Nat Methods. 2019 Mar;16(3):239-242. doi: 10.1038/s41592-019-0323-0. Epub 2019 Feb 8. 10.1038/s41592-019-0323-0 PubMed 30737497