Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

MS2_adRNA-MCP_ADAR2 DD_NES
(Plasmid #124706)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 124706 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MCP_ADAR2 DD_NES
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1626
  • Entrez Gene
    RAB7A (a.k.a. CMT2B, PRO2706, RAB7)
  • Promoter CMV
  • Tag / Fusion Protein
    • NES (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CMV Forward
  • 3′ sequencing primer TCCTTCCGTGTTTCAGTTAGCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Also expresses MS2_adRNA targeting the RAB7A transcript

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MS2_adRNA-MCP_ADAR2 DD_NES was a gift from Prashant Mali (Addgene plasmid # 124706 ; http://n2t.net/addgene:124706 ; RRID:Addgene_124706)
  • For your References section:

    In vivo RNA editing of point mutations via RNA-guided adenosine deaminases. Katrekar D, Chen G, Meluzzi D, Ganesh A, Worlikar A, Shih YR, Varghese S, Mali P. Nat Methods. 2019 Mar;16(3):239-242. doi: 10.1038/s41592-019-0323-0. Epub 2019 Feb 8. 10.1038/s41592-019-0323-0 PubMed 30737497