Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

SL016: AAV-CAG-FLEX-CheRiff-GFP
(Plasmid #124776)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 124776 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    AAV-CAG-FLEX
  • Backbone size w/o insert (bp) 5100
  • Total vector size (bp) 6800
  • Vector type
    AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CheRiff-GFP
  • Species
    Synthetic
  • Insert Size (bp)
    1700
  • Promoter CAG
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gcaacgtgctggttattgtg
  • 3′ sequencing primer tcacaaattttgtaatccag
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SL016: AAV-CAG-FLEX-CheRiff-GFP was a gift from Adam Cohen (Addgene plasmid # 124776 ; http://n2t.net/addgene:124776 ; RRID:Addgene_124776)
  • For your References section:

    Wide-area all-optical neurophysiology in acute brain slices. Farhi SL, Parot VJ, Grama A, Yamagata M, Abdelfattah AS, Adam Y, Lou S, Jun Kim J, Campbell RE, Cox DD, Cohen AE. J Neurosci. 2019 Apr 5. pii: JNEUROSCI.0168-19.2019. doi: 10.1523/JNEUROSCI.0168-19.2019. 10.1523/JNEUROSCI.0168-19.2019 PubMed 30952812