Skip to main content
Holiday Schedule: Addgene will be closed November 24th & 25th for the Thanksgiving Holiday. Order processing and shipping may be delayed during this week. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #124797)


Item Catalog # Description Quantity Price (USD)
Plasmid 124797 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 9227
  • Total vector size (bp) 11904
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
  • Alt name
    AXL tyrosine receptor kinase
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    AXL (a.k.a. ARK, JTK11, Tyro7, UFO)
  • Promoter TRE3GS

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site AgeI (unknown if destroyed)
  • 5′ sequencing primer AACGGACGTGAAGAATGTG
  • 3′ sequencing primer GCTTGGCAGCTCAGGTTGAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLVX-TetOne-Puro-hAXL was a gift from Kenneth Pienta (Addgene plasmid # 124797 ; ; RRID:Addgene_124797)
  • For your References section:

    AXL Is a Putative Tumor Suppressor and Dormancy Regulator in Prostate Cancer. Axelrod HD, Valkenburg KC, Amend SR, Hicks JL, Parsana P, Torga G, DeMarzo AM, Pienta KJ. Mol Cancer Res. 2019 Feb;17(2):356-369. doi: 10.1158/1541-7786.MCR-18-0718. Epub 2018 Oct 5. 10.1158/1541-7786.MCR-18-0718 PubMed 30291220