Skip to main content

pCS-CG-WT-Cer-VWF
(Plasmid #124827)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124827 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCS-CG
  • Total vector size (bp) 17094
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VWF with cyan fluorescent protein fusion between D'D3 and A1 domains
  • Species
    H. sapiens (human)
  • Entrez Gene
    VWF (a.k.a. F8VWF, VWD)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstB1 (not destroyed)
  • 3′ cloning site BstBI (not destroyed)
  • 5′ sequencing primer gcagagctggtttagtgaa
  • 3′ sequencing primer cagcattggtagctgctgta
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

I471V mutation in VWF has no impact on function

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCS-CG-WT-Cer-VWF was a gift from Sriram Neelamegham (Addgene plasmid # 124827 ; http://n2t.net/addgene:124827 ; RRID:Addgene_124827)
  • For your References section:

    von Willebrand factor self-association is regulated by the shear-dependent unfolding of the A2 domain. Zhang C, Kelkar A, Neelamegham S. Blood Adv. 2019 Apr 9;3(7):957-968. doi: 10.1182/bloodadvances.2018030122. 10.1182/bloodadvances.2018030122 PubMed 30936056