Skip to main content

PyronicSF-mRuby2/pBI-CMV1
(Plasmid #124830)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124830 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 124830-D50 50 μg of DNA in Tris buffer $495
DNA 124830-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pBI-CMV1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3097
  • Total vector size (bp) 5311
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    PyronicSF
  • Alt name
    Pyruvate Optical Nano-Indicator from CECs Single-Fluorophore
  • Species
    Synthetic
  • Insert Size (bp)
    1500
  • Promoter CMV

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CMV-F
  • 3′ sequencing primer SV40-pArev
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mRuby2
  • Species
    Synthetic
  • Insert Size (bp)
    714
  • Promoter CMV

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site PstI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer agtgccacctgacgtcggcagt
  • 3′ sequencing primer atcgcctggagaattcaccggt
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/611806v1 for BioRxiv preprint

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PyronicSF-mRuby2/pBI-CMV1 was a gift from Luis Felipe Barros (Addgene plasmid # 124830 ; http://n2t.net/addgene:124830 ; RRID:Addgene_124830)
  • For your References section:

    A highly responsive pyruvate sensor reveals pathway-regulatory role of the mitochondrial pyruvate carrier MPC. Arce-Molina R, Cortes-Molina F, Sandoval PY, Galaz A, Alegria K, Schirmeier S, Barros LF, San Martin A. Elife. 2020 Mar 6;9. pii: 53917. doi: 10.7554/eLife.53917. 10.7554/eLife.53917 PubMed 32142409