-
PurposeHighly resposive GFP-based pyruvate nanosensor.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124830 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBI-CMV1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3097
- Total vector size (bp) 5311
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namePyronicSF
-
Alt namePyruvate Optical Nano-Indicator from CECs Single-Fluorophore
-
SpeciesSynthetic
-
Insert Size (bp)1500
- Promoter CMV
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CMV-F
- 3′ sequencing primer SV40-pArev (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemRuby2
-
SpeciesSynthetic
-
Insert Size (bp)714
- Promoter CMV
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site PstI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer agtgccacctgacgtcggcagt
- 3′ sequencing primer atcgcctggagaattcaccggt (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/611806v1 for BioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PyronicSF-mRuby2/pBI-CMV1 was a gift from Luis Felipe Barros (Addgene plasmid # 124830 ; http://n2t.net/addgene:124830 ; RRID:Addgene_124830) -
For your References section:
A highly responsive pyruvate sensor reveals pathway-regulatory role of the mitochondrial pyruvate carrier MPC. Arce-Molina R, Cortes-Molina F, Sandoval PY, Galaz A, Alegria K, Schirmeier S, Barros LF, San Martin A. eLife. 2020 Mar 6;9. pii: 53917. doi: 10.7554/eLife.53917. 10.7554/eLife.53917 PubMed 32142409