Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

PyronicSF-mRuby2/pBI-CMV1
(Plasmid #124830)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 124830 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBI-CMV1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3097
  • Total vector size (bp) 5311
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    PyronicSF
  • Alt name
    Pyruvate Optical Nano-Indicator from CECs Single-Fluorophore
  • Species
    Synthetic
  • Insert Size (bp)
    1500
  • Promoter CMV

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CMV-F
  • 3′ sequencing primer SV40-pArev
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mRuby2
  • Species
    Synthetic
  • Insert Size (bp)
    714
  • Promoter CMV

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site PstI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer agtgccacctgacgtcggcagt
  • 3′ sequencing primer atcgcctggagaattcaccggt
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/611806v1 for BioRxiv preprint

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PyronicSF-mRuby2/pBI-CMV1 was a gift from Luis Felipe Barros (Addgene plasmid # 124830 ; http://n2t.net/addgene:124830 ; RRID:Addgene_124830)
  • For your References section:

    A highly responsive pyruvate sensor reveals pathway-regulatory role of the mitochondrial pyruvate carrier MPC. Arce-Molina R, Cortes-Molina F, Sandoval PY, Galaz A, Alegria K, Schirmeier S, Barros LF, San Martin A. Elife. 2020 Mar 6;9. pii: 53917. doi: 10.7554/eLife.53917. 10.7554/eLife.53917 PubMed 32142409