Skip to main content

pAAV-FLEX-SaCas9-U6-sgGria2
(Plasmid #124854)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124854 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX601
  • Vector type
    Mouse Targeting, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Gria2
  • gRNA/shRNA sequence
    TATTTCCAAGGGGCGCTGATC
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Gria2 (a.k.a. GluA2, GluR-B, Glur-2, Glur2, gluR-K2)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-FLEX-SaCas9-U6-sgGria2 was a gift from Larry Zweifel (Addgene plasmid # 124854 ; http://n2t.net/addgene:124854 ; RRID:Addgene_124854)
  • For your References section:

    Conditional Single Vector CRISPR/SaCas9 Viruses for Efficient Mutagenesis in the Adult Mouse Nervous System. Hunker AC, Soden ME, Krayushkina D, Heymann G, Awatramani R, Zweifel LS. Cell Rep. 2020 Mar 24;30(12):4303-4316.e6. doi: 10.1016/j.celrep.2020.02.092. 10.1016/j.celrep.2020.02.092 PubMed 32209486