pCAD104_Asn152Ser_pCMV6Entry-hIRG1
(Plasmid
#124877)
-
PurposeExpresses hCAD Asp152Ser mutant in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 124877 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV6-Entry
-
Backbone manufacturerOrigene
- Backbone size w/o insert (bp) 4831
- Total vector size (bp) 6274
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecis-aconitate decarboxylase
-
Alt nameIrg1
-
Alt nameCAD
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1443
-
Mutationmutated Asn152 to Ser
-
GenBank IDNM_001258406
-
Entrez GeneACOD1 (a.k.a. CAD, IRG1)
- Promoter CMV
-
Tag
/ Fusion Protein
- myc and FLAG tags (C terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CAGGAAACAGCTATGACC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThis plasmid was generated by mutagenesis of the plasmid CAT#: RC232825 purchased from Origene.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAD104_Asn152Ser_pCMV6Entry-hIRG1 was a gift from Konrad Buessow (Addgene plasmid # 124877 ; http://n2t.net/addgene:124877 ; RRID:Addgene_124877) -
For your References section:
Crystal structure of cis-aconitate decarboxylase reveals the impact of naturally occurring human mutations on itaconate synthesis. Chen F, Lukat P, Iqbal AA, Saile K, Kaever V, van den Heuvel J, Blankenfeldt W, Bussow K, Pessler F. Proc Natl Acad Sci U S A. 2019 Sep 23. pii: 1908770116. doi: 10.1073/pnas.1908770116. 10.1073/pnas.1908770116 PubMed 31548418