Skip to main content
Addgene
Open Menu

pCAD64_pCMV6_Entry_hIrg1
(Plasmid #124879)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124879 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 124879-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 124879-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pCMV6-Entry
  • Backbone manufacturer
    Origene
  • Backbone size w/o insert (bp) 4831
  • Total vector size (bp) 6274
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cis-aconitate decarboxylase
  • Alt name
    Irg1
  • Alt name
    CAD
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1443
  • Mutation
    mutated His103 to Ala
  • GenBank ID
    NM_001258406
  • Entrez Gene
    ACOD1 (a.k.a. CAD, IRG1)
  • Promoter CMV
  • Tag / Fusion Protein
    • myc and FLAG tags (C terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CAGGAAACAGCTATGACC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This plasmid was generated by mutagenesis of the plasmid CAT#: RC232825 purchased from Origene.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAD64_pCMV6_Entry_hIrg1 was a gift from Konrad Buessow (Addgene plasmid # 124879 ; http://n2t.net/addgene:124879 ; RRID:Addgene_124879)

  • For your References section:

    Crystal structure of cis-aconitate decarboxylase reveals the impact of naturally occurring human mutations on itaconate synthesis. Chen F, Lukat P, Iqbal AA, Saile K, Kaever V, van den Heuvel J, Blankenfeldt W, Bussow K, Pessler F. Proc Natl Acad Sci U S A. 2019 Sep 23. pii: 1908770116. doi: 10.1073/pnas.1908770116. 10.1073/pnas.1908770116 PubMed 31548418
Related items:
Commonly requested with: