Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

sgMlst8_1
(Plasmid #124909)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 124909 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    lentiCRISPRv2
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Mlst8
  • Alt name
    GbetaL
  • gRNA/shRNA sequence
    tggagttgagatcatacatg
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Mlst8 (a.k.a. 0610033N12Rik, AA409454, AI505104, AI851821, Gbl)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer hU6-F
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sgMlst8_1 was a gift from Jin Chen (Addgene plasmid # 124909 ; http://n2t.net/addgene:124909 ; RRID:Addgene_124909)
  • For your References section:

    Disruption of the Scaffolding Function of mLST8 Selectively Inhibits mTORC2 Assembly and Function and Suppresses mTORC2-Dependent Tumor Growth In Vivo. Hwang Y, Kim LC, Song W, Edwards DN, Cook RS, Chen J. Cancer Res. 2019 Jul 1;79(13):3178-3184. doi: 10.1158/0008-5472.CAN-18-3658. Epub 2019 May 13. 10.1158/0008-5472.CAN-18-3658 PubMed 31085701