pTagGFP2-N SIN1 delta2-29
(Plasmid
#124923)
-
PurposeFor expression of a.a.2-29 deletion mutant of SIN1-GFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124923 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepTagGFP2-N
-
Backbone manufacturerEvrogen
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMAPKAP1
-
Alt nameSIN1
-
Alt namemSIN1
-
SpeciesH. sapiens (human)
-
MutationInsert ORF was sirently mutated to be resistent to sgMAPKAP1_1.
-
Entrez GeneMAPKAP1 (a.k.a. JC310, MIP1, SIN1, SIN1b, SIN1g)
-
Tag
/ Fusion Protein
- TagGFP2 (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CMV Forward
- 3′ sequencing primer TagGFP-Rev, GCGCACGCTGAACTTGTGGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTagGFP2-N SIN1 delta2-29 was a gift from Jin Chen (Addgene plasmid # 124923 ; http://n2t.net/addgene:124923 ; RRID:Addgene_124923) -
For your References section:
Disruption of the Scaffolding Function of mLST8 Selectively Inhibits mTORC2 Assembly and Function and Suppresses mTORC2-Dependent Tumor Growth In Vivo. Hwang Y, Kim LC, Song W, Edwards DN, Cook RS, Chen J. Cancer Res. 2019 Jul 1;79(13):3178-3184. doi: 10.1158/0008-5472.CAN-18-3658. Epub 2019 May 13. 10.1158/0008-5472.CAN-18-3658 PubMed 31085701