OA-1045A
(Plasmid
#125003)
-
PurposeExpresses gRNAs targeting hid and eve
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 125003 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneattB
- Backbone size w/o insert (bp) 7473
- Total vector size (bp) 8870
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeve gRNA
-
gRNA/shRNA sequenceATCGTGCGGTGCTGAGAG
-
SpeciesD. melanogaster (fly)
-
Entrez Geneeve (a.k.a. Dmel_CG2328, 10.5, 10.9, 14.10, 20.35, CG2328, Dmel\CG2328, E(eve), EVE, Eve, F, V, VI, dm-eve, eve2, even, l(2)46CFg, l(2)46CFh, l(2)46CFj, l(2)46CFp, l(2)46Ce, l(2)46Cg)
- Promoter U6:3
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer aaaaatggtgggcataatagtgttgtt
- 3′ sequencing primer GGCTTCGAGACCGTGACCTACATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
OA-1045A was a gift from Omar Akbari (Addgene plasmid # 125003 ; http://n2t.net/addgene:125003 ; RRID:Addgene_125003)